|
ATCC
isocitrate dehydrogenase2 idh2 r140q Isocitrate Dehydrogenase2 Idh2 R140q, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/IDH2+mutant-TF-1+Isogenic+Cell+Line/10__1158_slash_1078___0432__ccr___20___3724-44-0-20 Average 94 stars, based on 1 article reviews
isocitrate dehydrogenase2 idh2 r140q - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
human aml cell line idh2 mutant tf 1 Human Aml Cell Line Idh2 Mutant Tf 1, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/TF-1/pmc07471081-39-1-11 Average 97 stars, based on 1 article reviews
human aml cell line idh2 mutant tf 1 - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
ApexBio
ag-221 b7804 Ag 221 B7804, supplied by ApexBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/ag+221+b7804/pmc09827114-199-0-1 Average 90 stars, based on 1 article reviews
ag-221 b7804 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Bio-Rad
qx200 droplet digital pcr system ![]() Qx200 Droplet Digital Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/QX200+Droplet+Reader/bio_rxiv__2021__08__12__456178-69-18-23 Average 98 stars, based on 1 article reviews
qx200 droplet digital pcr system - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
OriGene
human idh2 cdna ![]() Human Idh2 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/IDH2+(NM_002168)+Human+Untagged+Clone/pmc04499230-260-17-20 Average 90 stars, based on 1 article reviews
human idh2 cdna - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shidh Seeds Sales
shidh-1 ![]() Shidh 1, supplied by Shidh Seeds Sales, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/shidh+1/pmc03792474-114-21-22 Average 90 stars, based on 1 article reviews
shidh-1 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
vector pmscv iresyfp ii ![]() Vector Pmscv Iresyfp Ii, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/pMSCV-IRES-YFP+II+(pMIY+II)+(Plasmid+%2352108)/pm41481703-321-16-20 Average 92 stars, based on 1 article reviews
vector pmscv iresyfp ii - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
acat1antibody ![]() Acat1antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/ACAT1+Antibody/pm34289383-265-10-11 Average 93 stars, based on 1 article reviews
acat1antibody - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
idh1 r132c ![]() Idh1 R132c, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/pHAGE-IDH1-R132C+(Plasmid+%23116410)/pmc06796925-457-48-30 Average 90 stars, based on 1 article reviews
idh1 r132c - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
retro virus pbabe gfp ![]() Retro Virus Pbabe Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/pBABE+GFP+(Plasmid+%2310668)/pmc06796925-484-32-37 Average 93 stars, based on 1 article reviews
retro virus pbabe gfp - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
BPS Bioscience
idh2(r140q) assay kit ![]() Idh2(r140q) Assay Kit, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/IDH2(R140Q)+Assay+Kit/bps+bioscience___79309 Average 93 stars, based on 1 article reviews
idh2(r140q) assay kit - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
AutoMate Scientific Inc
axopatch amplifier ![]() Axopatch Amplifier, supplied by AutoMate Scientific Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/idh2+r140q+mutant/Axopatch+Amplifier/custom%40axopatch_200b_2%4037706660 Average 97 stars, based on 1 article reviews
axopatch amplifier - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Single Tube qPCR detection and quantitation of hotspot mutations down to 0.01% VAF
doi: 10.1101/2021.08.12.456178
Figure Lengend Snippet: (A). Clinical sample summary of comparative analytical results in IDH2 R140Q mutation. Sample results are shown for the As-BDA reactions and the ddPCR assays. The DNA input was roughly 15 ng for each As-BDA reaction, and 20 ng for each ddPCR assay. (B-C). As-BDA qPCR and ddPCR results of the wildtype sample. (D&G). As-BDA qPCR and ddPCR results of sample 3. Green qPCR curves showed amplification of As-BDA as the threshold was plotted as the black dashed line. In ddPCR plots, green dots are HEX (wildtype) positive droplets, blue dots are FAM (variant) positive droplets, red dots are droplets containing both wildtype and variant templates, and black dots represent empty droplets. (E&H). As-BDA qPCR and ddPCR results of sample 16. (F&I). As-BDA qPCR and ddPCR results of sample 19.
Article Snippet: ddPCR mutation assay dHsaMDV2010057 (Bio-Rad, 10049550) was used to quantitate IDH2 R140Q mutation and was performed on a
Techniques: Mutagenesis, Amplification, Variant Assay
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH2 mutants cooperate with class I mutations to promote leukemia. ( A ) Kaplan-Meier survival curve of mice transplanted with Flt3-ITD HSPCs transduced with empty MSCV-IRES-GFP vector (pMIG), IDH2 wild type (WT), or mutants (IDH2 R140Q and IDH2 R172K ). n = 9. ( B ) Kaplan-Meier survival curve of mice transplanted with Nras G12D HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). n = 9. ( C ) White blood cell (WBC) counts of mice transplanted with Flt3-ITD HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ) at 12 wk after transplantation. n = 5. ( D ) WBC counts of mice transplanted with Nras G12D HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ) at 12 wk after transplantation. n = 5. ( E ) Red blood cell (RBC) counts of mice transplanted with Flt3-ITD HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ) at 12 wk after transplantation. n = 5. ( F ) RBC counts of mice transplanted with Nras G12D HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ) at 12 wk after transplantation. n = 5. ( G ) Representative pictures of the spleens of recipient mice transplanted with Flt3-ITD or Nras G12D HSPCs transduced with empty vector (pMIG), IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( H ) Kaplan-Meier survival curve of the secondary recipient mice transplanted with Flt3-ITD or Nras G12D HSPCs transduced with IDH2 wild type or mutants (IDH2 R140Q and IDH2 R172K ). n = 5. (*) P < 0.05; (**) P < 0.01; (***) P < 0.001.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Transduction, Plasmid Preparation, Transplantation Assay
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH2 mutations result in AML. ( A ) Blood smear of recipient mice transplanted with Flt3-ITD or Nras G12D HSPCs transduced with IDH2 wild type (WT) or mutants (IDH2 R140Q and IDH2 R172K ). ( B ) H&E staining of BM sections (400×) of recipient mice transplanted with IDH2 wild-type- or mutant-expressing cells. ( C ) Representative flow plots of BM cells from recipient mice transplanted with Flt3-ITD or Nras G12D HSPCs transduced with IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( D ) Representative flow plots of splenocytes stained with Mac-1 and c-kit of recipients transplanted with Flt3-ITD cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( E ) Representative flow plots of peripheral blood stained with B220 and CD3 of recipients transplanted with Flt3-ITD cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( F ) Representative flow plots of peripheral blood stained with Mac-1 and Gr-1 of recipients transplanted with Flt3-ITD cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( G ) Representative flow plots of splenocytes stained with Mac-1 and CD19 of recipients transplanted with Nras G12D cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( H ) Representative flow plots of peripheral blood stained with CD19 and Thy1 of recipients transplanted with Nras G12D cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ). ( I ) Representative flow plots of peripheral blood stained with Mac-1 and c-kit of recipients transplanted with Nras G12D cells transduced with empty vector, IDH2 wild type, or mutants (IDH2 R140Q and IDH2 R172K ).
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Transduction, Staining, Mutagenesis, Expressing, Plasmid Preparation
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH2 mutant-induced AMLs display high 2-HG levels and altered DNA methylation and are chemoresistant. ( A ) 2-HG levels in BM, 32D, and MLL-AF9 or IDH2 mutant-induced AMLs. n = 3–5. ( B ) Representative dot blotting with antibodies against 5mC and 5hmC displaying DNA methylation of nonleukemic (BM and 32D) and leukemic cells. ( C ) Dose response of Nras G12D ;MLL-AF9, Nras G12D ;AML1-ETO, Nras G12D ;IDH2 R140Q , and Nras G12D ;IDH2 R172K leukemic cells to ara-C. Leukemic cells were treated with vehicle or 1–6000 nM ara-C for 3 d. n = 4. ( D ) Kaplan-Meier survival curve of mice transplanted with Nras G12D ;MLL-AF9 or Nras G12D ;IDH2 R172K leukemic cells treated with ara-C or vehicle. n = 5.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Mutagenesis, DNA Methylation Assay
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH2 mutations are sufficient to block differentiation of HSPCs and alter DNA methylation. ( A ) Schematic diagram of competitive transplant assay. Vector refers to transduction of cells with empty MSCV-IRES-GFP vector or one coexpressing wild-type IDH2 or an IDH2 mutant. CD45.1 c-kit + HSPCs (10 5 ) transduced with vectors were mixed with 2 × 10 5 CD45.2 BM and transplanted into lethally irradiated CD45.1 recipient mice. ( B ) Percentage of lin − Sca-1 + c-kit + (LSK) cells in the whole BM of recipient mice 12 wk after transplantation. n = 3. ( C ) Percentage of lin − Sca-1 − c-kit + (MP) cells in the whole BM of recipient mice 12 wk after transplantation. n = 3. ( D ) Percentage of c-kit + , Mac-1 + or Gr-1 + , B220 + or CD3 + , and Ter119 + cells in the whole BM of recipient mice 12 wk after transplantation. n = 3. ( E ) Percentage of GFP + cells in the whole BM of recipient mice 12 wk after transplantation. n = 3. ( F ) WBC counts of recipient mice with IDH2 wild-type- or mutant-expressing cells. n = 4–5. ( G ) BM cellularities of recipient mice with IDH2 wild-type- or mutant-expressing cells at 12 wk after transplantation. n = 3. ( H ) BrdU incorporation rate of LSK cells after 1 d of labeling. n = 3. ( I ) BrdU incorporation rate of MP cells after 1 d of labeling. n = 3. Of note, in B–G , vector, IDH2, or IDH2 mutants refers to mice transplanted with HSPCs transduced with the indicated vector but does not necessarily indicate that all of the cells analyzed expressed the constructs. Specifically, while BM from mice transplanted with IDH2 mutant cells almost completely consisted of GFP + IDH mutant-expressing cells (shown in E ), empty vector and wild-type IDH produced a competitive disadvantage, and BM consisted entirely of GFP − normal competitors at this time point.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Blocking Assay, DNA Methylation Assay, Plasmid Preparation, Transduction, Mutagenesis, Irradiation, Transplantation Assay, Expressing, BrdU Incorporation Assay, Labeling, Construct, Produced
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH2 mutants lead to abnormal DNA methylation in hematopoietic cells. ( A ) 2-HG levels in the whole BM cells of recipient mice. n = 3. ( B ) Representative dot blots showing 5mC and 5hmC levels of whole BM genomic DNA. ( C ) Relative mean fluorescence intensity (MFI) of 5hmC in GFP + BM cells. n = 3. ( D ) Relative MFI of 5mC in GFP + c-kit + BM cells. n = 3.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: DNA Methylation Assay, Fluorescence
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: Inhibition of IDH2 mutants leads to loss of 2-HG and delayed differentiation. ( A ) 2-HG levels of leukemic cells treated with 5 μM AGI-6780 for 2 d. n = 3. ( B ) Growth of leukemic cells treated with 5 μM AGI-6780 or vehicle. n = 4. ( C ) Representative H&E staining of cytospin of Nras G12D ;IDH2 R140Q and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 5 μM AGI-6780 at day 22. ( D ) Expression levels of Mac-1 by Nras G12D ;IDH2 R140Q and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 5 μM AGI-6780 at day 22. ( E ) Transcript levels of hIDH2 in Nras G12D ;IDH2 R172K cells expressing shRen or shIDH2, normalized to actin mRNA. n = 4. ( F ) Western blot demonstrating hIDH2 knockdown in Nras G12D ;IDH2 R172K leukemic cells by shRNAs against mutant IDH2. ( G ) Relative growth of NrasG12D;MLL-AF9 and Nras G12D ;IDH2 R172K leukemic cells with shRen or shIDH2. n = 3. ( H ) Expression levels of Mac-1 by Nras G12D ;IDH2 R140Q and Nras G12D ;IDH2 R172K leukemic cells treated with shRen or shIDH2.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Inhibition, Staining, Expressing, Western Blot, Knockdown, Mutagenesis
Journal: Genes & Development
Article Title: Cancer-associated IDH2 mutants drive an acute myeloid leukemia that is susceptible to Brd4 inhibition
doi: 10.1101/gad.226613.113
Figure Lengend Snippet: IDH mutant leukemias rapidly differentiate in response to Brd4 inhibition. ( A ) Relative growth of Nras G12D ;IDH2 R172K leukemic cells with Brd4 knockdown. n = 3. ( B ) Dose response of Nras G12D ;MLL-AF9, Nras G12D ;AML1-ETO, Nras G12D ;IDH2 R140Q , and Nras G12D ;IDH2 R172K to JQ1. Leukemic cells were treated with vehicle or 1–6000 nM JQ1 for 3 d. n = 4. ( C ) Representative flow plots showing Mac-1 expression levels in Nras G12D ;IDH2 R172K leukemic cells with shRen or shBrd4 3 d after doxycycline induction. ( D ) Representative flow plots showing Mac-1 expression levels in Nras G12D ;IDH2 R140Q and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 50 nM JQ1 for 2 d. ( E ) Representative cytospin staining of Nras G12D ;IDH2 R140Q and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 50 nM JQ1 for 2 d. ( F ) 2-HG levels of Nras G12D ;MLL-AF9, Nras G12D ;IDH2 R140Q , and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 50 nM JQ1 for 2 d. n = 3. ( G ) Western blotting of Myc levels in Nras G12D ;MLL-AF9, Nras G12D ;IDH2 R140Q , and Nras G12D ;IDH2 R172K leukemic cells treated with vehicle or 50 nM JQ1 for 2 d. The numbers indicate normalized Myc levels by densitometry. ( H ) WBC counts of Nras G12D ;IDH2 R172K recipient mice treated with vehicle or JQ1 at day 20 after transplant. Inserts show the representative blood smear of vehicle- or JQ1-treated mice. Vehicle, n = 4; JQ1, n = 5. ( I ) RBC counts of Nras G12D ;IDH2 R172K recipient mice treated with vehicle or JQ1 20 d after transplant. Vehicle, n = 4; JQ1, n = 5. ( J ) Kaplan-Meier survival curve of Nras G12D ;IDH2 R172K recipient mice treated with vehicle or JQ1. The mice were treated with vehicle or 50 mg/kg per day JQ1 by gavage from day 5 to day 18 after transplant. n = 5.
Article Snippet: Human IDH2 wild type and mutants R140Q and R172K were cloned into a pMIG vector ( ). shRNAs against Renilla (TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA),
Techniques: Mutagenesis, Inhibition, Knockdown, Expressing, Staining, Western Blot
Journal: Cell Research
Article Title: Vulnerabilities in mIDH2 AML confer sensitivity to APL-like targeted combination therapy
doi: 10.1038/s41422-019-0162-7
Figure Lengend Snippet: mIDH2 leukaemia are sensitive to ATRA and ATO. a Schematic representation of the metastable state of HoxA9/Meis1a/mIDH2 cells: LSD1 activation sensitizes to ATRA, while the effect of this pro-differentiating stimuli is counteracted by high PIN1 levels. Treatment of mIDH2 cells with pharmacological doses of ATRA targets PIN1 for degradation and enables full LSD1 activation to promote differentiation. b–c, Cytospin images and quantitation of human TF1 cell line stably overexpressing the mutant variant R140Q of IDH2 (mIDH2) and the respective controls (CTRL) that have been treated with pharmacological concentrations of ATRA (10–6M) or vehicle (DMSO). Data are means ± SD; t-test; *p ≤ 0.05. d Colony forming assay of mouse leukaemia cells harbouring mutant or wildtype IDH2 and treated with the PIN1 inhibitor (Juglone, 1 μM) or respective vehicle (VHL). Colonies were quantitated 12 days after plating. Data are means ± SD; one-way anova; ***p ≤ 0.001. e Colony forming assay of TF1 cells overexpressing the mIDH2 or respective control (CTRL) and treated with the PIN1 inhibitor (Juglone, 1 μM) or respective vehicle (VHL). Colonies were quantitated after 7 days from plating. Data are means ± SD; one-way anova; ***p ≤ 0.001. f Schematic representation of the metastable state of HoxA9/Meis1a/mIDH2 cells. Increased one-carbon (1C-) metabolism and oxidative stress (ROS) sensitize cells to pro-oxidant agents such as arsenic trioxide (ATO). Excessive and impaired scavenging of ROS induces DNA damage and leads to cell death. The induction of 1C-metabolism and glutathione synthesis is essential to ensure survival of leukaemia cells. Thus, block of this antioxidant effect by treatment with ATO pushes cells towards collapse and death. g Fold induction of cell death (Annexin V/7AAD positive cells) in mouse leukaemia cells isolated from second or third recipients and treated in vitro with ATO (0.5 μM) for 96 h. Data are means ± SD; t-test; *p ≤ 0.05. h Fold induction of cell death (Annexin V/7AAD positive cells) in TF1 leukaemia cells overexpressing IDH2R140Q and treated with ATO (0.5 μM) for 96 h. Data are means ± SD; t-test; ns not significant, *p ≤ 0.05. i Representative images of methylcellulose colony forming assay and colony quantification of mouse leukaemia cells isolated from second transplants (early stage) and treated in vitro with pharmacological concentrations of ATRA (1 μM), ATO (0.5 μM), a combination of both (ATRA + ATO), or vehicle (VHL) as a control. Treatments were performed in either the presence or absence of the IDH mutation (CTRL). Data are mean ± SD, one-way anova; **p ≤ 0.01, ***p ≤ 0.001. j Representative images of colony forming assay of HoxA9/Meis1A/mIDH2 mouse leukaemia cells isolated from third recipients (late stage) and treated with ATRA (1 μM), ATO (0.5 μM), a combination of both (ATRA + ATO), or vehicle (VHL) as a control. Histograms show the quantification of colony forming ability. Leukaemia cells were maintained on doxycycline (DOX ON) to favour the expression of the mIDH2 and increased 2HG levels or out of doxycycline (DOX OFF) to evaluate sensitivity in the context of mIDH-independence. Data are mean ± SD, one-way anova; ***p ≤ 0.001. k Quantification of colony forming ability of mouse leukaemia cells harbouring mutations in IDH2 (IDH2R140Q) or IDH1 (IDH1R132C) in association with multiple combinatorial genetic driver such as NPMc+ or FLT3ITD and treated with pharmacological concentrations of ATRA (1 μM), ATO (0.5 μM), a combination of both (ATRA + ATO), or vehicle (VHL) as a control. Non-mutant IDH2 cells such as MLL-AF9 or NPMc+/FLT3ITD were also included. Data are mean ± SD; one-way anova; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. See also Supplementary Information, Figs. S4–S7
Article Snippet: Vectors and constructs To generate stable lines for mutant IDH expression, TF1 and U937 cells were infected with lenti-virus pLVX-IRES –neo vector (Clontech #6321810) or pCIG3 (pCMV-IRES_GFP, from Felicia Goodrum,
Techniques: Activation Assay, Quantitation Assay, Stable Transfection, Mutagenesis, Variant Assay, Blocking Assay, Isolation, In Vitro, Expressing